Here you will find a brief description of the dataset
Seeds of white lupin (Lupinus albus L. cv. Amiga, from Florimond Desprez, France) were germinated for 4 days on vermiculite soaked with water. Thereafter, the seedlings were transferred to an aerated nutrient solution in the absence of phosphate in growth chambers under controlled conditions (16h light/8h dark, 25°C day/20°C night, 65% relative humidity and PAR intensity 200 μmol.m².s⁻¹).
After 12 days of culture, ten cluster roots coming from four independently grown plants were harvested and dissected in eight parts of 0.5-cm from the apex of the lateral root that carries the cluster root. As a control, 1 cm of lateral roots without cluster roots, sampled 1 cm away from the primary root, were collected. Four biological replications were produced for each experiment.
A total of 2,048,118,650 paired-end reads of 150 pb were sequenced using an Illumina NovaSeq6000 Sequencer. To remove low quality sequences, the RNA-seq reads were checked and trimmed with a minimum quality score of 30 in both 3’ and 5’ end. The resulting reads shorter than 35 pb have been discarded. The quality checked RNA-seq reads were then mapped onto white lupin reference genome using Hisat2. Transcripts were assembled and quantified using Stringtie. Gene counts were extracted and imported into the R package DESeq2. These counts have been normalized according to the size factor computed by DESeq2.
For small RNA sequencing, 24 independent root RNA-seq libraries were constructed and sequenced at Transcriptomic Platform IPS2 (IPS2, Paris, France). The NEXTflex™ Small RNA-Seq kit was used for generation of small RNA-seq libraries according to the manufacturer’s protocol. All small RNA libraries were sequenced on an Illumina NextSeq 500 sequencing platform, using a single-end, 75 nt read metric instrument according to the manufacturer’s instructions. A total of 460,506,072 reads of 75 nt were sequenced. Small RNA-seq reads were trimmed using cutadapt version 1.11 1 to remove remnants of the following 3’-adapter sequence. Only sequences that had the adapter were kept, insuring that they are small fragments. The adapter trimming was performed based on the adapter sequence: TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC of 33 nucleotides long, removing the adapter if the length of the match is at least 10 nts. A second round of trimming was performed with cutadapt to remove the four nts on the 5’ and 3’ ends of the reads (which corresponded to the four degenerated nts on each “High Definition” (HD) adapter). Empty reads (adapter dimer) and all the sequences shorter than 15 nucleotides were discarded. A total of 424,385,998 trimmed reads were kept for final analysis. The sequence files produced were collapsed to include only non-redundant reads and the number of occurrences of each.